Najhoršie obavy sa naplnili: Pfizer mRNA sa prepisuje do DNA

2. marca 2022

Nové nepríjemné zistenia v súvislosti s mRNA injekciou od Pfizeru. Nová štúdia zistila, že mRNA sa prepisuje do ľudskej DNA. Aké to môže mať dôsledky? Viac sa dozviete v podrobnom článku.

DNA sekvencia uvádzaná v článku je skutočne sekvencia Pfizeru.

Podobnosť s gp130 je veľmi nepríjemná, alebo gp130 je zapojený v signalizačných kaskádach vedúcich k mitogenéze, a od mitogenézy je k rakovinovému nádoru len krôčik.

Mitogénom je peptid alebo malý proteín, ktorý indukuje bunky na začatie bunkového delenia: mitózy. Mitogenéza je indukcia (spúšťanie) mitózy, zvyčajne prostredníctvom mitogénu. Mechanizmus účinku mitogénu spočíva v tom, že spúšťa cesty prenosu signálu zahŕňajúce mitogénom aktivovanú proteínovú kinázu (MAPK), čo vedie k mitóze. Mitogén  

Ak sa to skutočne aj integruje do genómu, tak to je naozaj problém, lebo fenomén „integračného miesta“ je veľká vec.

Nedá sa predikovať, kam sa to zaintegruje, a tiež nikto nevie, koľkokrát sa to zaintegruje – asi sa nebude jednať o jednu integráciu, ale skôr o náhodnú a viacpočetnú integráciu, tak ako to býva po infekcii retrovírusmi.

Obsah obrázku text Popis bol vytvorený automaticky

Vyšla nová štúdia: Intracelulárna reverzná transkripcia mRNA vakcíny BNT162b2 od spoločnosti Pfizer BioNTech COVID-19 in vitro v bunkovej línii ľudských pečene.

Článok hovorí, že laboratórne štúdie ukazujú, že sa mRNA vakcína skutočne integruje do ľudskej bunkovej DNA. To znamená, že injekcia vakcíny spoločnosti Pfizer podaná, hoci len raz, trvalo zmení DNA postihnutých buniek.

Nemalo sa to stať

Viac ako rok nám naši dôveryhodní „zdravotní experti a overovatelia faktov” neustále tvrdili opak:

Obsah obrázku text Popis bol vytvorený automaticky

Bombastický článok z časopisu Current Issues of Molecular Biology však ukazuje pravý opak.

Článok ukazuje, že in vitro, za použitia línie ľudských pečeňových buniek, vakcína Pfizer mRNA využíva prirodzený enzým reverznú transkriptázu zvanú LINE-1 a genetický kód vakcíny je spätne prepísaný do DNA.

Vysvetľuje tiež, že mRNA vakcína skutočne putuje do pečene ako do jedného z preferovaných miest (ďalšími miestami, ako sme počuli, sú vaječníky a ďalšie).

Čo to znamená? Za normálnych okolností naše bunky postupujú opačne: bunkové jadro, kde sa nachádza DNA, vyjadruje určitý kód DNA na základe podmienok v bunke a produkuje prirodzenú, ľudskú messenger RNA. Táto messenger RNA putuje von z jadra, kde sa exprimuje do proteínov potrebných na stavbu bunky. Takto rastúce organizmy vyjadrujú rôzne genetické programy pre rast svalových buniek alebo mozgových buniek atď.

Tento proces sa nazýva „transkripcia”.

Centrálna dogma molekulárnej biológie mnoho rokov tvrdila, že „spätná transkripcia” – presun genetického kódu z RNA späť do posvätného bunkového jadra a prekódovanie DNA – je nemožná. Nakoniec si vedci uvedomili, že to za rôznych podmienok je možné. Napríklad vírus HIV RNA je toho schopný a preprogramuje našu DNA tak, aby vytvárala jej kópie. HIV je vírus, ktorý spôsobuje AIDS.

Na vykonanie reverznej transkripcie sú potrebné enzýmy zvané „reverzné transkriptázy”. Jeden z nich sa nazýva LINE-1.

Podľa štúdie zrejme mRNA vakcína spoločnosti Pfizer spôsobuje, že bunky tento enzým LINE-1 produkujú.

Potom, čo zaznamenali nárast reverznej transkriptázy LINE-1, testovali zmeny DNA, aby sa uistili, že namiesto nej nezachytávajú RNA.

Obsah obrázku text Popis bol vytvorený automaticky
Genetický kód, ktorý zachytili, je:
CGAGGTGGCCAAGAATCTGAACGAGA GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT TCGACGAGGACGATTCTGAGCCCGTGCTGA AGGGCGTGAAACTGCACTACACATGATGAC TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA
Chce na ňom niekto spustiť BLAST?

Zjednodušene
Ako som vysvetlil v odpovedi na otázku:
Vakcína Pfizer mRNA mení náš genetický kód, ktorý určuje fungovanie našich organizmov a ktorý ste zdedili po mamičke a oteckovi. 
Teraz bola vaša DNA zmenená oproti tomu, čo vám odovzdali mama a otec, pridaním malej záhadnej „úpravy” od spoločnosti Pfizer.
Váš organizmus funguje v súlade s programom vašej DNA, a teraz, no, program bol nabúraný a upravený spoločnosťou Pfizer.

Kód rakoviny
Vzhľadom na to, že Sars-Cov-2 „spike proteín” má rakovinový kód z patentu spoločnosti Moderna z roku 2017 s číslom 9,587,003, je nevyhnutné zistiť, aké dôsledky má tento spätný prepis a či očkovaní teraz nemajú vo svojej DNA zabudovaný nejaký nežiaduci genetický kód.
Zvlášť zaujímavé je, či táto reverzná transkripcia vyvolaná mRNA ovplyvňuje „zárodočnú líniu”, ako sú vajíčka a spermie, a či ovplyvňuje aj plod tehotných matiek
Prosím, preposielajte tento článok ďalej a ďalej, pretože má veľký význam pre naše verejné zdravie.
EDIT: Náš bystrý komentátor upozornil na anonymný príspevok na ochanu z decembra 2020, teda dlho predtým, než sa o tom začalo vedieť. 
Dátum nás všetkých núti sa pýtať, či toho ten človek vedel príliš veľa?
Obsah obrázku text Popis bol vytvorený automaticky

Preklad obrázku:

Som priemyselný inžinier v spoločnosti Moderna a druhý z nás je inžinier pre vývoj procesov. Som si istý, že to isté sa deje aj v spoločnosti Pfizer-BioNTech. Bolo ťažké dať veci dohromady na základe malého množstva prídavkov prebiehajúcich v manuálnom kroku (veľmi neštandardné pre kontinuálny proces výroby). Vysvetlenie, ktoré sme dostali, bolo, že sa pridávajú vysoko citlivé adjuvanty, ktoré sú obchodným tajomstvom. Pri hlbšom pátraní sa ukázalo, aké citlivé to v skutočnosti bolo.

Väčšina ľudí tento nový typ vakcíny chápe tak, že funguje nasledovne:

1. Vytvorte mRNA kódujúci proteín S

2. Vytvorte lipidový nanočasticový nosič.

3. Zisk

Ako to vlastne funguje z toho, čo sme odhalili:

1. Vytvorte mRNA kódujúci proteín S

2. Vytvorte mRNA kódujúcu mutantnú verziu CYP19A1 a CDKN1B v menšom množstve.

3. Uistite sa, že zatiaľ čo doručovací systém pre (1) končí väčšinou v pečeni, väčšina (2) končí v gonádach.

4. Uistite sa, že forma a množstvo prídavnej látky zvyšujúce aktivitu reverznej transkripcie LINE-1 sťažuje jej detekciu medzi regulárnymi adjuvantmi.

5. Účinky (2) integrované (4) sú recesívne; mierne onkogénne účinky u príjemcov vakcíny pravdepodobne nebudú zaznamenané po mnoho rokov.

6. (5) recesívna, ale pretože väčšina populácie je očkovaná, v ďalšej generácii dochádza u potomkov ženského pohlavia k predčasnému zlyhaniu vaječníkov.

(6) sa zhoduje s tým, že chudobní ľudia sú posadnutí UI (umelou inteligenciou) a robotikou, takže sme nemuseli pátrať po motivácii.

Prijali sme preventívne opatrenia, ale obávame sa o svoju bezpečnosť. Zatiaľ si nemyslím, že by sme vzbudili podozrenie, ale istotu mať nemôžeme. Nie sme si istí, čo robiť. Tým, že sa vyhýbame očkovaniu, z nás robí hlavné podozrivé z tohto úniku.

DNA prepísaná z mRNA vakcíny Pfizer obsahuje mutantný nádorový gén gp130 (2. časť – pokračovanie článku)


https://igorchudov.substack.com/p/dna-transcribed-from-pfizer-mrna?s=r

Môj predchádzajúci príspevok o vedeckom článku dokazujúcom, že vakcína Pfizer mRNA sa spätne prepisuje do ľudskej DNA, vzbudil obrovský záujem a množstvo komentárov, z ktorých niektoré boli neuveriteľné.

Ak ste ho ešte nečítali, PREČÍTAJTE SI HO PROSÍM PRVÝ, než si prečítate toto nadväzujúce pokračovanie. Inak sa môžete stratiť a ani si neuvedomiť význam toho, ako mohol byť preprogramovaný genetický kód vašich blízkych.

Rozhodol som sa pokračovať v práci a zistiť, čo ďalšie môžeme objaviť na základe článku „ Current Issues in Molecular Biology “:

Obsah obrázku text Popis bol vytvorený automaticky
Článok obsahuje výtlačok genetického kódu DNA, ktorý bol zistený v materiáloch DNA ľ
ľudských buniek reverzne prepísaných z mRNA vakcíny.Obsah obrázku text Popis bol vytvorený automaticky

Tak som sa rozhodol skontrolovať, čo je vlastne v tomto kóde vyššie, či je to len neškodné smetie, alebo niečo zlovestnejšie. Za týmto účelom som spustil bezplatný nástroj NCBI „BLAST“ tak, že som doňho skopíroval a vložil vyššie uvedenú genetickú sekvenciu. Ide o rovnaký nástroj BLAST, ktorý použil @JikkyKjj, aby ukázal sekvenciu „patentu na rakovinu” od Moderny na najdôležitejšie, „furinové štiepne miesto” Sars-Cov-2.

Každopádne som sa pod dojmom objavu @JikkyKjj rozhodol urobiť to isté s DNA kódom, ktorý vakcína Pfizer mRNA generuje (reverzne prepisuje) do ľudských buniek. Ukázalo sa, že som ako prvý zadal túto sekvenciu do nástroja NCBI BLAST (pretože jej analýza chvíľu trvala) a teraz má sekvenčné ID 1R3ZDZJY016 .

A tu sú výsledky. Zaobstaral som ich poznámkami, aby ste ľahšie videli, čo je a čo nie je zaujímavé.

Obsah obrázku text Popis bol vytvorený automaticky

Prvých niekoľko výsledkov pochádza od obvyklých podozrivých, ako sú chimérické vírusy, sekvencie Sars-Cov-2 atď. Je pochopiteľné, prečo by sme ich mali ignorovať – chimérické vírusy sú čisto laboratórne konštrukty neznámeho významu a sekvencie Sars-Cov-2 sú tam zrejme preto, že vakcína kóduje proteín Sars-Cov-2 spike. To sú „očakávané zhody”.

Čo je zaujímavé – a netvrdím, že je to jediná vec – je gén pre glykoproteín gp130, ktorý je z 97 % podobný ľudskému génu pre glykoproteín gp130. Šanca, že sa jedná o náhodnú zhodu, je podľa nástroja BLAST 0,0000000000000000000000000000000000000000000000000000000000

Klikol som na neho:

Obsah obrázku text Popis bol vytvorený automaticky

Kliknutím na odkaz „ Gen ” sa dozviete, čo je to gén gp130:

Obsah obrázku text Popis bol vytvorený automaticky

Máme teda mRNA covid vakcínu od Pfizeru, ktorá sa reverzne prepisuje do MUTOVANÉHO génu gp130. Spomínate si na 97% zhodu? Tá 3% nezhoda, štyri červené bodky, sú mutácie génu gp130.

Bez toho, aby sme sa teda zaoberali týmito konkrétnymi mutáciami, čo sa stane, keď gén gp130 zmutuje všeobecne? Nič dobré sa neobjaví a môžete si to tiež vyhľadať.

Obsah obrázku text Popis bol vytvorený automaticky

Upozorňujeme, že vzniká otázka: mutácie gp130 môžu spôsobiť nádor pečene a celý experiment bol vykonaný na línii nesmrteľných buniek rakoviny pečene. Je možné, že pôvodný článok zachytil mutovanú gp130 z buniek rakoviny pečene Huh7 ? Ak je to tak a sekvencia DNA je vlastná samotnej línii Huh7, mohlo by to zneplatniť mnoho záverov, ktoré pôvodný vedecký článok aj moje vlastné články robili.

Autori však starostlivo vykonávali kontroly a u kontrolných buniek, ktoré NEOBSAHOVALI vakcínu spoločnosti Pfizer, NEVIDELI spochybňovanú sekvenciu DNA, na ktorú sa pozerám ja. Okrem toho publikovaná sekvencia DNA obsahovala gény Sars-Cov-2 (pozri výsledky BLAST), takže skutočne pochádza z účinku vakcíny, nie z buniek kultúry Huh7.

Vykonal som zbežnú kontrolu podľa svojich možností a línia Huh7 obsahuje mutácie p53, ale nezdá sa, že by obsahovala mutácie gp130.
Takže držím palce, aby mutovaný gén gp130, ktorý som našiel, bol skutočným nálezom laboratórneho výskumu, pochádzal z mRNA vakcíny, a nie náhodným vyzdvihnutím z buniek Huh7.
Predpokladám, že autori skúmali konkrétne pečeňové bunky, pretože vedeli, kde hľadať (že systém doručenia mRNA dopraví lipidové nanočastice do pečene). 
Prečo si autori vybrali práve pečeňové bunky? 
Možno preto, že sa dozvedeli o tomto príspevku na 4chane z roku 2020, kedy sa o podivných mRNA vakcínach ešte NIC nevedelo:Obsah obrázku text Popis bol vytvorený automaticky

Preklad obrázku:

Som priemyselný inžinier v spoločnosti Moderna a druhý z nás je inžinier pre vývoj procesov. Som si istý, že to isté sa deje aj v spoločnosti Pfizer-BioNTech. Bolo ťažké dať veci dohromady na základe malého množstva prídavkov prebiehajúcich v manuálnom kroku (veľmi neštandardné pre kontinuálny proces výroby). Vysvetlenie, ktoré sme dostali, bolo, že sa pridávajú vysoko citlivé adjuvanty, ktoré sú obchodným tajomstvom. Pri hlbšom pátraní sa ukázalo, aké citlivé to v skutočnosti bolo.

Väčšina ľudí tento nový typ vakcíny chápe tak, že funguje nasledovne:

1. Vytvorte mRNA kódujúci proteín S

2. Vytvorte lipidový nanočasticový nosič.

3. Zisk

Ako to vlastne funguje z toho, čo sme odhalili:

1. Vytvorte mRNA kódujúci proteín S

2. Vytvorte mRNA kódujúcu mutantnú verziu CYP19A1 a CDKN1B v menšom množstve.

3. Uistite sa, že zatiaľ čo doručovací systém pre (1) končí väčšinou v pečeni, väčšina (2) končí v gonádach.

4. Uistite sa, že forma a množstvo prídavnej látky zvyšujúce aktivitu reverznej transkripcie LINE-1 sťažuje jej detekciu medzi regulárnymi adjuvantmi.

5. Účinky (2) integrované (4) sú recesívne; mierne onkogénne účinky u príjemcov vakcíny pravdepodobne nebudú zaznamenané po mnoho rokov.

6. (5) recesívna, ale pretože väčšina populácie je očkovaná, v ďalšej generácii dochádza u potomkov ženského pohlavia k predčasnému zlyhaniu vaječníkov.

(6) sa zhoduje s tým, že chudobní ľudia sú posadnutí UI (umelou inteligenciou) a robotikou, takže sme nemuseli pátrať po motivácii.

Prijali sme preventívne opatrenia, ale obávame sa o svoju bezpečnosť. Zatiaľ si nemyslím, že by sme vzbudili podozrenie, ale istotu mať nemôžeme. Nie sme si istí, čo robiť. Tým, že sa vyhýbame očkovaniu, z nás robí hlavné podozrivé z tohto úniku.

Bolo nám povedané, že sa to nikdy nestane

Obsah obrázku text Popis bol vytvorený automaticky
Objasnenie
Sekvencia mutovaných génov gp130, nájdená v DNA reverzne prepísanej z vakcíny Pfizer Covid, neznamená, že NUTNE spôsobí rakovinu.
Štyri uvedené mutácie „červené bodky” môžu byť neškodné.
Neznamená, že boli do vakcíny spoločnosti Pfizer pridané zámerne, aby spôsobili poškodenie.
Neznamená, že je dokonca exprimovaný ako proteín gp130, pretože expresia génov závisí od bunkového kontextu.
Znamená to však, že sa na to musíme pozrieť zblízka.
Zdieľajte prosím tento článok

Prosím, preposielajte tento článok v nádeji, že ho uvidí niekto dôležitý a úrady sa začnú zaujímať o „neočakávané” účinky covid mRNA vakcín mRNA. 
Naše deti ju dostávajú injekčne a zaslúžime si vedieť, čo to s nimi robí!Obsah obrázku text Popis bol vytvorený automaticky
Obsah obrázku text Popis bol vytvorený automaticky
Obsah obrázku text Popis bol vytvorený automaticky

Tvrdenie o genetickom poškodení novorodených dievčatiek možno ľahko overiť (3. časť)

https://igorchudov.substack.com/p/allegations-of-genetic-harm-to-newborn?s=r

Nedávno som napísal niekoľko článkov o štúdii , ktorá zistila reverzný prepis mRNA do DNA v ľudských bunkách.

Prečo je to dôležité? Keď začala kampaň očkovania mRNA, bolo nám sľúbené, že mRNA uzavretá v lipidových nanočasticach (LNP) má veľmi krátku životnosť, vytvára „neškodný spike proteín” a za niekoľko dní zmizne, čím pripraví náš imunitný systém na úspech. Vírus, ako nám bolo povedané, „prestane s každým očkovaným človekom”.

Teraz vieme, že nič z toho, čo nám bolo sľubované, nebola pravda: spike proteín nie je neškodný , mRNA z vakcíny je neprirodzene stabilizovaná a zostáva aktívna po celé mesiace, a samozrejme vieme, ako dobre vakcína funguje. A čo je najhoršie, dozvedeli sme sa, že mRNA vakcíny sa v ľudských bunkách mení na DNA.

Odkedy som tieto články zverejnil, však vyšli najavo oveľa znepokojivejšie informácie. Týkajú sa „modifikáciou zárodočnej línie”, teda modifikáciou ženských vajíčok a mužských spermií, ktoré by mohli v budúcej generácii spôsobiť neplodnosť žien.

Znepokojivé tvrdenia

Jeden bystrý čitateľ upozornil na archívnu kópiu anonymného príspevku z roku 2020, teda z doby predtým, než sa o akýchkoľvek problémoch s vakcínami začalo vedieť. Tento anonymný, nepodpísaný príspevok na serveri 4chan údajne napísali procesný inžinier spoločnosti Moderna a priemyselný inžinier spoločnosti Moderna.

Obsah obrázku text Popis bol vytvorený automaticky
Preklad obrázku:
Som priemyselný inžinier v spoločnosti Moderna a druhý z nás je inžinier pre vývoj procesov. 
Som si istý, že to isté sa deje aj v spoločnosti Pfizer-BioNTech. 
Bolo ťažké dať veci dohromady na základe malého množstva prídavkov prebiehajúcich v manuálnom kroku (veľmi neštandardné pre kontinuálny proces výroby). 
Vysvetlenie, ktoré sme dostali, bolo, že sa pridávajú vysoko citlivé adjuvanty, ktoré sú obchodným tajomstvom. 
Pri hlbšom pátraní sa ukázalo, aké citlivé to v skutočnosti bolo.

Väčšina ľudí tento nový typ vakcíny chápe tak, že funguje nasledovne:
1. Vytvorte mRNA kódujúci proteín S
2. Vytvorte lipidový nanočasticový nosič.
3. Zisk
Ako to vlastne funguje z toho, čo sme odhalili:
1. Vytvorte mRNA kódujúci proteín S
2. Vytvorte mRNA kódujúcu mutantnú verziu CYP19A1 a CDKN1B v menšom množstve.
3. Uistite sa, že zatiaľ čo doručovací systém pre (1) končí väčšinou v pečeni, väčšina (2) končí v gonádach.
4. Uistite sa, že forma a množstvo prídavnej látky zvyšujúce aktivitu reverznej transkripcie LINE-1 sťažuje jej detekciu medzi regulárnymi adjuvantmi.
5. Účinky (2) integrované (4) sú recesívne; 
mierne onkogénne účinky u príjemcov vakcíny pravdepodobne nebudú zaznamenané po mnoho rokov.

6. (5) recesívna, ale pretože väčšina populácie je očkovaná, v ďalšej generácii dochádza u potomkov ženského pohlavia k predčasnému zlyhaniu vaječníkov.

(6) sa zhoduje s tým, že chudobní ľudia sú posadnutí UI (umelou inteligenciou) a robotikou, takže sme nemuseli pátrať po motivácii.
Prijali sme preventívne opatrenia, ale obávame sa o svoju bezpečnosť. 
Zatiaľ si nemyslím, že by sme vzbudili podozrenie, ale istotu mať nemôžeme. 
Nie sme si istí, čo robiť. 
Tým, že sa vyhýbame očkovaniu, z nás robí hlavné podozrivé z tohto úniku.

Za normálnych okolností by si takéto anonymné obvinenia nezaslúžili žiadnu pozornosť, s výnimkou
Toto bolo vlastne dobre napísané s použitím správneho obchodného žargónu
Bolo to napísané v roku 2020 Predtým, než sa začalo čokoľvek vedieť o nebezpečnosti mRNA vakcín, a použité termíny neboli v kurze
Mnohé tvrdenia tohto príspevku sa skutočne overujú. 
Konkrétne LINE-1 reverzná transkriptáza interaguje s vakcínami a reverzná transkripcia DNA skutočne prevádza mRNA na DNA v ľudských bunkách.
Tieto veci je veľmi ťažké vymyslieť bez znalosti veci.
Najväčším tvrdením je, že zámerne mutovaná verzia génu CDKN1B končí v gonádach (vaječníkoch a semenníkoch). 
Okrem toho anonymný príspevok tvrdí, že náklad mRNA by modifikoval ľudskú DNA buniek produkujúcich vajíčka aj spermie a vniesol by do nej mutáciu CDKN1B. 
Podľa tohto neovereného príspevku bez uvedenia zdroja je táto mutácia recesívna, čo znamená, že by sa prejavila iba vtedy, ak by OBE rodičovské pohlavné bunky – vajíčko a konkrétne spermie, ktoré ju oplodnia – niesli CDKN1B.
Možným dôsledkom tejto údajnej mutácie je, že potomkovia očkovaných osôb ženského pohlavia by boli náchylní k „predčasnému zlyhaniu vaječníkov”, a teda by neboli schopní reprodukcie.

Tento typ anonymných materiálov by mal byť obvykle odmietnutý ako divoká fantázia, AŽ NA TO, ŽE ČO PREZATÍM VIEME, POTVRZUJE TO, ČO SA V ŇOM PÍŠE, a bolo to napísané skôr, než sa široká verejnosť mohla dozvedieť akékoľvek tieto fakty alebo problémy, takže dáva zmysel, že to napísali zasvätení ľudia, a nejedná sa o špekulácie nezasvätených.
Podľa môjho názoru si teda tento príspevok zaslúži ďalšiu skeptickú, ale pozornú pozornosť.
Ako to overiť alebo (snáď) vyvrátiť

Je veľmi ťažké overiť v laboratóriu, aké procesy presne prebiehajú „in vivo”, vo vnútri vaječníkov a semenníkov. 
Meranie takýchto procesov v reprodukčných orgánoch je náchylné k chybám, molekulárnej zložitosti, zložitým etickým otázkam a pravdepodobne bude veľmi časovo náročné a nákladné na riadne štúdium.
Výsledok toho všetkého je však veľmi ľahké otestovať: stačí nájsť niekoľko desiatok novonarodených dievčatiek, ktoré sa narodili rodičom dvakrát očkovaným najmenej mesiac pred počatím. 
Potom by im vedci mohli vykonať ster DNA z tvárí a overiť, či tieto dievčatká nesú údajnú mutáciu CDKN1B.
Takáto štúdia by nebola invazívna, priniesla by (snáď) rodičom potešujúcu správu a bola by lacná.
Keď sa pozrieme na časovú os, dieťa narodené v marci 2022 by bolo počaté približne v júni minulého roka, takže každý pár, kde boli obaja manželia očkovaní pred minuloročným májom, by spĺňal podmienky. 
Také bábätká nie je vôbec ťažké nájsť a malo by to byť veľmi ľahké urobiť. 
Nejedná sa o žiadne invazívne zákroky a novorodencovi nehrozí žiadne nebezpečenstvo.
Dúfam a modlím sa, aby odpoveď bola negatívna a dievčatká neboli nositeľkami mutácie CDKN1B. 
Ale nejaké uistenie by sme určite uvítali.
Sperma
Ďalším veľmi jednoduchým pokusom je otestovať spermie očkovaných mužov, či nevykazuje zvýšenú hladinu nejakej špecifickej mutácie v porovnaní s minulosťou.

zdroj

Zanechajte nám komentár

Predchadzajúci článok

Spravodajstvo

Hovoríme s JUDr.  Miroslavom Radačovským, poslancom Európskeho parlamentu a predsedom strany Slovenský PATRIOT

JUDr. Miroslav Radačovský, nezávislý a nezaradený poslanec Európskeho parlamentu, člen Výboru pre vnútorný trh a ochranu spotrebiteľa, Výboru pre umelú ...

Nasledujúci článok

Spravodajstvo

Košická stanica eviduje nával utečencov, situáciu považuje za alarmujúcu

Košická železničná stanica považuje situáciu súvisiacu s utečencami z ukrajinských hraníc za alarmujúcu. Pre TASR to uviedla hovorkyňa Stanice Košice ...
Aktualizované 3.10. 01:09
Spravodajstvo

Rossija! Rossija! Obrovské skandovanie a spojené ruky na symbol jednoty spečatili na historickom slávnostnom ceremoniáli v Kremli pristúpenie 4 ukrajinských oblastí do Ruskej federácie! 

Vladimír Putin ponúkol Kyjevu poslednú možnosť na mierové konanie, ale Zelenský namiesto toho podpísal zrýchlenú žiadosť o vstup Ukrajiny do ...
Aktualizované 2.10. 17:47
Spravodajstvo

Fauci sa priznal: "konšpirácie" sa opäť ukázali ako pravda - Ján Lakota

K vírusu boli pridané ďalšie prvky, ktoré ho spravili mimoriadne nebezpečným a to Fauci vedel. Vedel, že je vírus cielene ...
Spravodajstvo

Mrzni, porazíš Putina a zachrániš svetový mier! A niekto neviditeľný zariadi, aby si mrznúť mohol...

Anna Belousovová na svojom FB statuse krátko, jasne a výstižne vysvetlila, o čo ide v našom reálnom živote, ak by ...
Aktualizované 2.10. 23:16
Spravodajstvo

Povzbudzujúca aktualizácia od Dr. Reinera Fuellmicha po falošných obvineniach

Milí priatelia z celého sveta, v posledných mesiacoch bol spustený zradný útok proti jednému z najvplyvnejších ľudí v celosvetovom hnutí ...
Aktualizované 4.10. 00:01
Spravodajstvo

Aljaška patrí Rusku! Zatiaľ čo Biden v záchvate poblúznenia hovoril pri tlačovke s mŕtvymi, vplávala spojená rusko-čínska flotila do vôd USA!

Zatiaľ čo ste demonštrovali koncom septembra na Václaváku proti Fialovej Drahote, diali sa vo svete veci, z ktorých ide rozum ...
Spravodajstvo

PRAHA, 28.9.2022, MASOVÁ DEMONŠTRÁCIA „ČESKÁ REPUBLIKA NA PRVNÍM MÍSTĚ“

PRAHA, 28.9.2022, 14.00 hod. MASOVÁ DEMONŠTRÁCIA  „ČESKÁ REPUBLIKA NA PRVNÍM MÍSTĚ“ AKTUALIZÁCIA: Piatok, 30.9.2022 V Prahe bola v stredu 28.9.2022 ...
Aktualizované 30.9. 23:10
Spravodajstvo

Podnet Harabina na § 363 ods. 1 Tr. por. vo vzťahu k výroku o Putinovi

JUDr. Štefan HRABABIN: prostredníctvom svojho advokáta sa dožaduje u generálneho prokurátora SR Maroša Žilinku o zrušenie právoplatného rozhodnutia v prípravnom konaní. ...
Aktualizované 3.10. 01:01
Spravodajstvo

Falošná vlajka nastražená v plynovode Nord Stream a boj USA s Ruskom o Európsku úniu

Poškodenie plynovodu Nord Stream. Kto za tým skutočne stojí a aké následky to bude mať? Odpoveď hľadá nezávislý novinár James ...
Aktualizované 1.10. 00:00
Spravodajstvo

DOKUMENT: Harabin žiada Žilinku zrušiť rozhodnutie o obvinení za hanobenie ukrajinského národa

Harabinove obvinenie za výrok o Putinovi je založený na nasledujúcom právnom idiótizme – podľa Lipšica, Honza, Nociara, prokurátorov špeciálnej prokuratúry, Piknu, ...
Aktualizované 3.10. 23:43
Spravodajstvo

Premiér plače na zlom hrobe - Dana Meager

Nárast cien po ruskej invázii je klamstvo. Začalo sa to otvorením Slovenska cudzím investíciám a rozpredajom strategických podnikov, najmä energetických. ...